2017-04-25 07:39:102025-05-14 11:52:27
description
low affinity potassium transporter KtrC-KtrD, peripheric membrane component
glutamate-controlled potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component
locus
BSU14510
BSU_14510
geneLength
663
666
product
low affinity potassium transporter KtrC-KtrD, peripheric membrane component (proton symport)
glutamate-controlled potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component
outlinks
bsu
BSU14510
BSU_14510
Gene
Coordinates
1,520,531 → 1,521,196
1,520,531 1,521,196
The protein
Paralogous protein(s)
[[protein|KtrA]]
[[this]]
The protein
[SW|Domains]
contains a [SW|RCK_N domain] at the N-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]
contains a [SW|RCK_N domain] at the N-terminus (aa 4-126)(according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (aa 135-219) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]
The protein
Effectors of protein activity
the protein binds c-di-AMP [Pubmed|23671116]
binds ADP and ATP [pubmed|30753894]
the protein binds c-di-AMP, KD = 30 nM, this results in inhibition of potassium uptake [Pubmed|30753894]
the affinity of [[protein|KtrC]]-[[protein|KtrD]] for potassium is strongly increased in the presence of glutamate [pubmed|32253343]
The protein
Structure
[PDB|4J7C] (the [[protein|KtrA]]-[[protein|KtrB]] complex, 56% identity) [Pubmed|23598340]
[PDB|4XTT] (the ''S. aureus'' KtrA [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]
[PDB|4J7C] (the [[protein|KtrA]]-[[protein|KtrB]] complex, 56% identity) [Pubmed|23598340]
[PDB|6I8V] ([[protein|KtrC]] in complex with ATP) [Pubmed|30753894]
[PDB|4XTT] (the ''S. aureus'' [[protein|KtrA]] [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]
Biological materials
Mutant
MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]
GHB6 ([[gene|ktrC]]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955
GP2264 ([[gene|ktrC]]::''aphA3''), available in [SW|Jörg Stülke]'s lab
GP2079 ([[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab
GP2083 (D([[gene|ktrA]]-[[gene|ktrB]])::''aphA3'' D''[[gene|ktrC]]''::''tet''), available in [SW|Jörg Stülke]'s lab
MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]
GHB6 ([[gene|ktrC]]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955
GP2264 (''Δ''''[[gene|ktrC]]''::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP2048 (''Δ''''[[gene|ktrC]]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP2079 (''Δ''''[[gene|ktrC]]''::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP2771 (''Δ''''[[gene|ktrC]]''::''spec''), available in [SW|Jörg Stülke]'s lab
GP2083 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3'' [[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
BKE14510 ([[gene|ktrC]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
BKK14510 ([[gene|ktrC]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
Biological materials
Expression vector
pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
pGP2994: expression of Strep-KtrC in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
pGP2995: expression of KtrC-Strep in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
Labs working on this gene/protein
[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
References
Reviews
References
Original publications
The protein
Protein family
KtrA potassium transport family (with [[protein|KtrA]], according to UniProt)
The protein
Kinetic information
the [[protein|KtrC]]-[[protein|KtrD ]]channel has a low affinity for potassium, this is determined by [[protein|KtrD]] [pubmed|30753894]
the affinity of [[protein|KtrC]]-[[protein|KtrD]] for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) [pubmed|32253343]
Biological materials
Expression vectors
pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
labs
[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
[SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
[SW|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]